application biosystem 7500 real-time pcr system (Thermo Fisher)
90
Structured Review
Thermo Fisher
application biosystem 7500 real-time pcr system
Application Biosystem 7500 Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/application+time/application+biosystem+7500+real+time+pcr+system/pm40139472-40-1-7
Average 90 stars, based on 1 article reviews
Application Biosystem 7500 Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/application+time/application+biosystem+7500+real+time+pcr+system/pm40139472-40-1-7
Average 90 stars, based on 1 article reviews
application biosystem 7500 real-time pcr system - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Protease Inhibitor:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Software:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Article Title: Article Snippet: The reaction mixture underwent quantitative PCR on ViiA 7, or QuantStudio 7, or QuantStudio 12K Flex systems (Thermo Fisher). .. The results were processed and exported from Article Title: Humanized Mouse Models of Epstein Barr Virus Infection Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Article Title: Deltaviruses spread through a viral Trojan Horse. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 Single Cell:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Imaging:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Article Title: Deltaviruses spread through a viral Trojan Horse. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 Bicinchoninic Acid Protein Assay:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 cDNA Synthesis:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Polymerase Chain Reaction:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Article Title: Humanized Mouse Models of Epstein Barr Virus Infection Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 Isolation:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Staining:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Enzyme-linked Immunosorbent Assay:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Microscopy:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Article Title: Deltaviruses spread through a viral Trojan Horse. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 Real-time Polymerase Chain Reaction:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Article Title: Article Snippet: The reaction mixture underwent quantitative PCR on ViiA 7, or QuantStudio 7, or QuantStudio 12K Flex systems (Thermo Fisher). .. The results were processed and exported from Article Title: Humanized Mouse Models of Epstein Barr Virus Infection Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Article Title: Deltaviruses spread through a viral Trojan Horse. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 FACS:Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 other:Article Title: Posttranscriptional control of hepatic CEACAM1 3 ′ UTR by human antigen R (HuR) mitigates sterile liver inflammation Article Snippet: 247 Application Gene Primer Duplex Pair RT-PCR AlbCre (mt) 5’-GAAGCAGAAGCTTAGGAAGATGG-3’ AlbCre (wt) 5’-TTGGCCCCTTACCATAACTG-3’ 5’- TGCAAACATCACATGCACAC-3’ Ceacam1-L 5’-GCTGGCATCGTGATTGGAGTTGTGG-3’ 5’-AGAGTTGTCAGAAGGAGCCAGATTG-3’ Ceacam1-S 5’-GCTGGCATCGTGATTGGAGTTGTGG-3’ 5’-AGAGTTGTCAGAAGGAGCCAGATCC-3’ Elavl1 5’-TAGGCTCTGGGATGAAACCT-3’ 5’-CTCTCCAGGCAGATGAGCA-3’ GAPDH 5’-GTCTCCTCTGACTTCAACAGCG-3’ 5’-ACCACCCTGTTGCTGTAGCCAA-3’ Article Title: miR-363-5p and IL-34 Mediated Modulation of Pacemaker Channel, HCN4, on iPSC-CM; Translation into the Human Sinus Node Microenvironment. Article Snippet: The raw data was acquired and exported to Article Title: Overcoming BET-inhibitor JQ1 resistance in aggressive non-small cell lung cancer by inducing ferroptosis via inhibition of the BRD2-FTH1 axis. Article Snippet: Real-time PCR results were analyzed using Protein Purification:Article Title: Humanized Mouse Models of Epstein Barr Virus Infection Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Immunohistochemistry:Article Title: Humanized Mouse Models of Epstein Barr Virus Infection Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Mass Measurement:Article Title: Humanized Mouse Models of Epstein Barr Virus Infection Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Adhesive:Article Title: Humanized Mouse Models of Epstein Barr Virus Infection Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Cell Culture:Article Title: Humanized Mouse Models of Epstein Barr Virus Infection Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Transferring:Article Title: Humanized Mouse Models of Epstein Barr Virus Infection Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Positron Emission Tomography:Article Title: Deltaviruses spread through a viral Trojan Horse. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 Membrane:Article Title: Deltaviruses spread through a viral Trojan Horse. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 Pore Size:Article Title: Deltaviruses spread through a viral Trojan Horse. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 Transmission Assay:Article Title: Deltaviruses spread through a viral Trojan Horse. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 Capsules:Article Title: Deltaviruses spread through a viral Trojan Horse. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 Reverse Transcription Polymerase Chain Reaction:Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 SYBR Green Assay:Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 Flow Cytometry:Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 Sequencing:Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil. Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 |