Review



application biosystem 7500 real-time pcr system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher application biosystem 7500 real-time pcr system
    Application Biosystem 7500 Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/application+time/application+biosystem+7500+real+time+pcr+system/pm40139472-40-1-7
    Average 90 stars, based on 1 article reviews
    application biosystem 7500 real-time pcr system - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Protease Inhibitor:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Software:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Article Title:
    Article Snippet: The reaction mixture underwent quantitative PCR on ViiA 7, or QuantStudio 7, or QuantStudio 12K Flex systems (Thermo Fisher). .. The results were processed and exported from QuantStudio Real Time PCR Software (Thermo Fisher). qPCR result interpretation. ..

    Article Title: Humanized Mouse Models of Epstein Barr Virus Infection
    Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Sorvall ST40R (Thermo Fisher Scientific) PCR 8‐tube strips (VWR, 732‐1517) 384‐well LightCycler plate (Sarstedt, 72.1985.202) CFX384 Real‐Time PCR detection system (BioRad, C1000 Touch Thermal Cycler) TOMO IHC adhesive glass slides (Biosystems, TOM‐11/90) Software: Prism (GraphPad, Version 10.6.0) Phenochart (AKOYA Biosciences, Version 1.1.1) InForm (AKOYA Biosciences, Version 3.0.0) Vectra (AKOYA Biosciences, Version 3.0.7) Additional basic equipment: Herasafe laminar flow hood; class II (Thermo Fisher Scientific) Infrared lamp (in house) Mouse restrainer (in house) Multiwell 24‐well plates (Falcon, 353047) Nunc cell culture dish (Thermo Scientific, 153066) Omnican Syringe, U‐100 Insulin (Braun, 91511255) Pipetgirl (Vitaris) 5‐ml round‐bottom polystyrene tube with cell strainer cap (Falcon, 352235) Scissors (in house) Stainless steel surgical blades (Swann‐Morton, 0301) 3.5‐ml transfer pipette (Sarstedt, 86.1171.001) Tweezers (in house) ..

    Article Title: Deltaviruses spread through a viral Trojan Horse.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 N/A AreTomo2 Zheng et al. 66 N/A SerialEM Mastronarde 64 N/A Other Heraeus Multifuge X3 FR Thermo Fisher Scientific N/A TX-1000 swinging rotor Thermo Fisher Scientific N/A ImageXpress Pico microscope Molecular Devices N/A OPTIMA L-80 XP Beckman N/A SW 32Ti swinging rotor Beckman N/A Fiberlite F15-8 x 50cy fixed angle rotor Thermo Fisher Scientific N/A Fresco 21 centrifuge Thermo Fisher Scientific N/A Amicon-Ultra centrifugal filters Merck N/A SL 16R centrifuge Thermo Fisher Scientific N/A Trans-Blot Turbo Transfer System Bio-Rad N/A Odyssey M Infrared Imaging System LI-COR Biosciences N/A ChemiDoc system Bio-Rad N/A CFX Opus 384 Real-Time PCR System Bio-Rad N/A IX71 microscope Evident N/A PELCO Easyslicer Ted pella 11000 PET membrane insert (clear extended culture, 0.4-μm pore size) Sabeu 9300422 Andor Dragonfly spinning disk microscope Oxford Instruments N/A LSM980 8Y microscope with Airyscan 2 module ZEISS N/A ExpertLine STED microscope Abberior Instruments N/A JEM-1011 Transmission Electron Microscope JEOL N/A QuantiFoil Copper R 1.2/1.3 300-mesh holey carbon grids Micro Tools N/A Glacios cryo-TEM Thermo Fisher Scientific N/A Leica EM GP2 Leica N/A JEOL2200FS microscope JEOL N/A JPK CoverslipHolder Bruker N/A NanoWizard IVxp atomic force microscope Bruker Nano N/A BL-AC40TS probes Olympus N/A qpBioAC-CB3 Nanosensors N/A Pelco Biowave Pro+ tissue processor Ted pella N/A Beem embedding capsules size 3 EMS 69910 (Continued on next page) ll OPEN ACCESS e4 Cell 189, 1–14.e1–e10, April 30, 2026 Please cite this article in press as: McKellar et al., Deltaviruses spread through a viral Trojan Horse, Cell (2026), https://doi.org/10.1016/ j.cell.2026.01.037 Article .. NIH3T3 (CVCL_0594), Vero (CVCL_0059), Huh7.5 (CVCL_7927), HEK293T (CVCL_0063) and BHK-21 (CVCL_1914) were grown in Dulbecco’s Modified Eagle Medium (DMEM), high glucose (Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS) (Dutscher) and Antibiotic-Antimycotic 1X (Thermo Fisher Scientific) at 37 ◦ C, 5% CO 2 .

    Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 QdotTM585 streptavidin conjugate Invitrogen #Q10111MP Software FlowJo 8.7 FlowJo, 385 Williamson Way Ashland, OR 97520 USA https://www.flowjo.com/ Fiji 2.1.0/1.53c Image J, NIH, Bethesda, USA https://fiji.sc GraphPad Prism 9 GraphPad Prism 225 Franklin Street Boston, MA 02110 USA https:// www.graphpad.com Other Flow cytometer (LSRII) BD N/A DM2500 light/fluorescence microscope Leica N/A Axio Vision microscope Zeiss N/A Quantitative PCR instrument: StepOnePlus ABI 7500 sequence detection system Applied Biosystems N/A ..

    Single Cell:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Imaging:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Article Title: Deltaviruses spread through a viral Trojan Horse.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 N/A AreTomo2 Zheng et al. 66 N/A SerialEM Mastronarde 64 N/A Other Heraeus Multifuge X3 FR Thermo Fisher Scientific N/A TX-1000 swinging rotor Thermo Fisher Scientific N/A ImageXpress Pico microscope Molecular Devices N/A OPTIMA L-80 XP Beckman N/A SW 32Ti swinging rotor Beckman N/A Fiberlite F15-8 x 50cy fixed angle rotor Thermo Fisher Scientific N/A Fresco 21 centrifuge Thermo Fisher Scientific N/A Amicon-Ultra centrifugal filters Merck N/A SL 16R centrifuge Thermo Fisher Scientific N/A Trans-Blot Turbo Transfer System Bio-Rad N/A Odyssey M Infrared Imaging System LI-COR Biosciences N/A ChemiDoc system Bio-Rad N/A CFX Opus 384 Real-Time PCR System Bio-Rad N/A IX71 microscope Evident N/A PELCO Easyslicer Ted pella 11000 PET membrane insert (clear extended culture, 0.4-μm pore size) Sabeu 9300422 Andor Dragonfly spinning disk microscope Oxford Instruments N/A LSM980 8Y microscope with Airyscan 2 module ZEISS N/A ExpertLine STED microscope Abberior Instruments N/A JEM-1011 Transmission Electron Microscope JEOL N/A QuantiFoil Copper R 1.2/1.3 300-mesh holey carbon grids Micro Tools N/A Glacios cryo-TEM Thermo Fisher Scientific N/A Leica EM GP2 Leica N/A JEOL2200FS microscope JEOL N/A JPK CoverslipHolder Bruker N/A NanoWizard IVxp atomic force microscope Bruker Nano N/A BL-AC40TS probes Olympus N/A qpBioAC-CB3 Nanosensors N/A Pelco Biowave Pro+ tissue processor Ted pella N/A Beem embedding capsules size 3 EMS 69910 (Continued on next page) ll OPEN ACCESS e4 Cell 189, 1–14.e1–e10, April 30, 2026 Please cite this article in press as: McKellar et al., Deltaviruses spread through a viral Trojan Horse, Cell (2026), https://doi.org/10.1016/ j.cell.2026.01.037 Article .. NIH3T3 (CVCL_0594), Vero (CVCL_0059), Huh7.5 (CVCL_7927), HEK293T (CVCL_0063) and BHK-21 (CVCL_1914) were grown in Dulbecco’s Modified Eagle Medium (DMEM), high glucose (Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS) (Dutscher) and Antibiotic-Antimycotic 1X (Thermo Fisher Scientific) at 37 ◦ C, 5% CO 2 .

    Bicinchoninic Acid Protein Assay:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    cDNA Synthesis:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Polymerase Chain Reaction:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Article Title: Humanized Mouse Models of Epstein Barr Virus Infection
    Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Sorvall ST40R (Thermo Fisher Scientific) PCR 8‐tube strips (VWR, 732‐1517) 384‐well LightCycler plate (Sarstedt, 72.1985.202) CFX384 Real‐Time PCR detection system (BioRad, C1000 Touch Thermal Cycler) TOMO IHC adhesive glass slides (Biosystems, TOM‐11/90) Software: Prism (GraphPad, Version 10.6.0) Phenochart (AKOYA Biosciences, Version 1.1.1) InForm (AKOYA Biosciences, Version 3.0.0) Vectra (AKOYA Biosciences, Version 3.0.7) Additional basic equipment: Herasafe laminar flow hood; class II (Thermo Fisher Scientific) Infrared lamp (in house) Mouse restrainer (in house) Multiwell 24‐well plates (Falcon, 353047) Nunc cell culture dish (Thermo Scientific, 153066) Omnican Syringe, U‐100 Insulin (Braun, 91511255) Pipetgirl (Vitaris) 5‐ml round‐bottom polystyrene tube with cell strainer cap (Falcon, 352235) Scissors (in house) Stainless steel surgical blades (Swann‐Morton, 0301) 3.5‐ml transfer pipette (Sarstedt, 86.1171.001) Tweezers (in house) ..

    Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 QdotTM585 streptavidin conjugate Invitrogen #Q10111MP Software FlowJo 8.7 FlowJo, 385 Williamson Way Ashland, OR 97520 USA https://www.flowjo.com/ Fiji 2.1.0/1.53c Image J, NIH, Bethesda, USA https://fiji.sc GraphPad Prism 9 GraphPad Prism 225 Franklin Street Boston, MA 02110 USA https:// www.graphpad.com Other Flow cytometer (LSRII) BD N/A DM2500 light/fluorescence microscope Leica N/A Axio Vision microscope Zeiss N/A Quantitative PCR instrument: StepOnePlus ABI 7500 sequence detection system Applied Biosystems N/A ..

    Isolation:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Staining:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Enzyme-linked Immunosorbent Assay:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Microscopy:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Article Title: Deltaviruses spread through a viral Trojan Horse.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 N/A AreTomo2 Zheng et al. 66 N/A SerialEM Mastronarde 64 N/A Other Heraeus Multifuge X3 FR Thermo Fisher Scientific N/A TX-1000 swinging rotor Thermo Fisher Scientific N/A ImageXpress Pico microscope Molecular Devices N/A OPTIMA L-80 XP Beckman N/A SW 32Ti swinging rotor Beckman N/A Fiberlite F15-8 x 50cy fixed angle rotor Thermo Fisher Scientific N/A Fresco 21 centrifuge Thermo Fisher Scientific N/A Amicon-Ultra centrifugal filters Merck N/A SL 16R centrifuge Thermo Fisher Scientific N/A Trans-Blot Turbo Transfer System Bio-Rad N/A Odyssey M Infrared Imaging System LI-COR Biosciences N/A ChemiDoc system Bio-Rad N/A CFX Opus 384 Real-Time PCR System Bio-Rad N/A IX71 microscope Evident N/A PELCO Easyslicer Ted pella 11000 PET membrane insert (clear extended culture, 0.4-μm pore size) Sabeu 9300422 Andor Dragonfly spinning disk microscope Oxford Instruments N/A LSM980 8Y microscope with Airyscan 2 module ZEISS N/A ExpertLine STED microscope Abberior Instruments N/A JEM-1011 Transmission Electron Microscope JEOL N/A QuantiFoil Copper R 1.2/1.3 300-mesh holey carbon grids Micro Tools N/A Glacios cryo-TEM Thermo Fisher Scientific N/A Leica EM GP2 Leica N/A JEOL2200FS microscope JEOL N/A JPK CoverslipHolder Bruker N/A NanoWizard IVxp atomic force microscope Bruker Nano N/A BL-AC40TS probes Olympus N/A qpBioAC-CB3 Nanosensors N/A Pelco Biowave Pro+ tissue processor Ted pella N/A Beem embedding capsules size 3 EMS 69910 (Continued on next page) ll OPEN ACCESS e4 Cell 189, 1–14.e1–e10, April 30, 2026 Please cite this article in press as: McKellar et al., Deltaviruses spread through a viral Trojan Horse, Cell (2026), https://doi.org/10.1016/ j.cell.2026.01.037 Article .. NIH3T3 (CVCL_0594), Vero (CVCL_0059), Huh7.5 (CVCL_7927), HEK293T (CVCL_0063) and BHK-21 (CVCL_1914) were grown in Dulbecco’s Modified Eagle Medium (DMEM), high glucose (Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS) (Dutscher) and Antibiotic-Antimycotic 1X (Thermo Fisher Scientific) at 37 ◦ C, 5% CO 2 .

    Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 QdotTM585 streptavidin conjugate Invitrogen #Q10111MP Software FlowJo 8.7 FlowJo, 385 Williamson Way Ashland, OR 97520 USA https://www.flowjo.com/ Fiji 2.1.0/1.53c Image J, NIH, Bethesda, USA https://fiji.sc GraphPad Prism 9 GraphPad Prism 225 Franklin Street Boston, MA 02110 USA https:// www.graphpad.com Other Flow cytometer (LSRII) BD N/A DM2500 light/fluorescence microscope Leica N/A Axio Vision microscope Zeiss N/A Quantitative PCR instrument: StepOnePlus ABI 7500 sequence detection system Applied Biosystems N/A ..

    Real-time Polymerase Chain Reaction:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    Article Title:
    Article Snippet: The reaction mixture underwent quantitative PCR on ViiA 7, or QuantStudio 7, or QuantStudio 12K Flex systems (Thermo Fisher). .. The results were processed and exported from QuantStudio Real Time PCR Software (Thermo Fisher). qPCR result interpretation. ..

    Article Title: Humanized Mouse Models of Epstein Barr Virus Infection
    Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Sorvall ST40R (Thermo Fisher Scientific) PCR 8‐tube strips (VWR, 732‐1517) 384‐well LightCycler plate (Sarstedt, 72.1985.202) CFX384 Real‐Time PCR detection system (BioRad, C1000 Touch Thermal Cycler) TOMO IHC adhesive glass slides (Biosystems, TOM‐11/90) Software: Prism (GraphPad, Version 10.6.0) Phenochart (AKOYA Biosciences, Version 1.1.1) InForm (AKOYA Biosciences, Version 3.0.0) Vectra (AKOYA Biosciences, Version 3.0.7) Additional basic equipment: Herasafe laminar flow hood; class II (Thermo Fisher Scientific) Infrared lamp (in house) Mouse restrainer (in house) Multiwell 24‐well plates (Falcon, 353047) Nunc cell culture dish (Thermo Scientific, 153066) Omnican Syringe, U‐100 Insulin (Braun, 91511255) Pipetgirl (Vitaris) 5‐ml round‐bottom polystyrene tube with cell strainer cap (Falcon, 352235) Scissors (in house) Stainless steel surgical blades (Swann‐Morton, 0301) 3.5‐ml transfer pipette (Sarstedt, 86.1171.001) Tweezers (in house) ..

    Article Title: Deltaviruses spread through a viral Trojan Horse.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 N/A AreTomo2 Zheng et al. 66 N/A SerialEM Mastronarde 64 N/A Other Heraeus Multifuge X3 FR Thermo Fisher Scientific N/A TX-1000 swinging rotor Thermo Fisher Scientific N/A ImageXpress Pico microscope Molecular Devices N/A OPTIMA L-80 XP Beckman N/A SW 32Ti swinging rotor Beckman N/A Fiberlite F15-8 x 50cy fixed angle rotor Thermo Fisher Scientific N/A Fresco 21 centrifuge Thermo Fisher Scientific N/A Amicon-Ultra centrifugal filters Merck N/A SL 16R centrifuge Thermo Fisher Scientific N/A Trans-Blot Turbo Transfer System Bio-Rad N/A Odyssey M Infrared Imaging System LI-COR Biosciences N/A ChemiDoc system Bio-Rad N/A CFX Opus 384 Real-Time PCR System Bio-Rad N/A IX71 microscope Evident N/A PELCO Easyslicer Ted pella 11000 PET membrane insert (clear extended culture, 0.4-μm pore size) Sabeu 9300422 Andor Dragonfly spinning disk microscope Oxford Instruments N/A LSM980 8Y microscope with Airyscan 2 module ZEISS N/A ExpertLine STED microscope Abberior Instruments N/A JEM-1011 Transmission Electron Microscope JEOL N/A QuantiFoil Copper R 1.2/1.3 300-mesh holey carbon grids Micro Tools N/A Glacios cryo-TEM Thermo Fisher Scientific N/A Leica EM GP2 Leica N/A JEOL2200FS microscope JEOL N/A JPK CoverslipHolder Bruker N/A NanoWizard IVxp atomic force microscope Bruker Nano N/A BL-AC40TS probes Olympus N/A qpBioAC-CB3 Nanosensors N/A Pelco Biowave Pro+ tissue processor Ted pella N/A Beem embedding capsules size 3 EMS 69910 (Continued on next page) ll OPEN ACCESS e4 Cell 189, 1–14.e1–e10, April 30, 2026 Please cite this article in press as: McKellar et al., Deltaviruses spread through a viral Trojan Horse, Cell (2026), https://doi.org/10.1016/ j.cell.2026.01.037 Article .. NIH3T3 (CVCL_0594), Vero (CVCL_0059), Huh7.5 (CVCL_7927), HEK293T (CVCL_0063) and BHK-21 (CVCL_1914) were grown in Dulbecco’s Modified Eagle Medium (DMEM), high glucose (Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS) (Dutscher) and Antibiotic-Antimycotic 1X (Thermo Fisher Scientific) at 37 ◦ C, 5% CO 2 .

    Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 QdotTM585 streptavidin conjugate Invitrogen #Q10111MP Software FlowJo 8.7 FlowJo, 385 Williamson Way Ashland, OR 97520 USA https://www.flowjo.com/ Fiji 2.1.0/1.53c Image J, NIH, Bethesda, USA https://fiji.sc GraphPad Prism 9 GraphPad Prism 225 Franklin Street Boston, MA 02110 USA https:// www.graphpad.com Other Flow cytometer (LSRII) BD N/A DM2500 light/fluorescence microscope Leica N/A Axio Vision microscope Zeiss N/A Quantitative PCR instrument: StepOnePlus ABI 7500 sequence detection system Applied Biosystems N/A ..

    FACS:

    Article Title: Extracellular matrix-driven metabolic control of pancreatic endocrine lineage allocation.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6 (M. musculus) In house NA Itga3+/−; Itga6+/− mice (M. musculus) De Arcangelis et al, 1999 MGI:1857792 MGI:1857793 NGN3-GFP (SA121) ES cells (H. sapiens) Löf-Öhlin et al, 2017 NA HUES4 ES cells (H. sapiens) Harvard University BioSamples: SAMEA114214019 Antibodies Anti-insulin (1:400) DAKO #A0564 RRID:AB_10013624 Anti-E-cadherin (1:400) Takara #M108 RRID:AB_2895157 Anti-glucagon (1:1000) Sigma #G2654 RRID:AB_259852 Anti-ITGA3 (1:100) R&D #AF2787 RRID:AB_2129595 Anti-ITGA6 (1:200) Millipore #MAB1378 RRID:AB_2128317 Anti-ITGA5 (1:100) Abcam #ab-150361 RRID:AB_2631309 Anti-ITGAV (1:100) Abcam #ab-63490 RRID:AB_1140041 Anti-COLIV (1:100) Merck #AB769 RRID:AB_92262 Anti-LAMA1 (1:100) T. Sasaki, Oita University #1057+ RRID:NA © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on N ovem ber 8, 2025 from IP 2400:1a00:4ba5:c093:f5ff:4dcd:7589:c171. .. Reagent/resource Reference or source Identifier or catalog number SuperScript III Thermo Fisher #18080085 RIPA buffer Thermo Fisher #8990 Laemmli reducing SDS buffer Thermo Fisher #J60015.AC Protease inhibitor Thermo Fisher #A32953 Software Adobe Illustrator 2023 Adobe Fiji 2.0/ImageJ http://imagej.nih.gov/ij NIH Image Venny 2.1.0 https://bioinfogp.cnb.csic.es/tools/ venny/ Oliveros, 2007 ILASTIK v1.4.0.post1 https://ilastik.org Berg et al, 2019 GraphPad Prism 10 https://www.graphpad.com GraphPad FCS express 7 https://denovosoftware.com De Novo Software RStudio https://posit.co/downloads/ RStudio R package DESeq2 v1.34.0 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Love et al, 2014 R package MAST v1.30.0 Finak et al, 2015 R package Seurat v5.3.0 https://cran.r-project.org/web/ packages/Seurat/index.html Hao et al, 2023 STAR v2.7.2 d https://github.com/alexdobin/STAR/ releases Dobin et al, 2013 FastQC v0.11.9 http:// www.bioinformatics.babraham.ac.uk/ projects/fastqc Babraham Bioinformatics group multiqc v1.7 https://multiqc.info Ewels et al, 2016 3DSuite https://imagej.net/plugins/3d-imagejsuite/ Ollion et al, 2013 Single-cell transcriptomic and spatial map of the human fetal pancreas Shiny App https:// www.humanpancreasdevelopment.org/ (Olaniru et al, 2023) Other Ibidi μ-Slide 8 wellhigh slides Ibidi #80806 Ibidi 12-well slides for imaging Ibidi #80801 PierceTM BCA Protein Assay Kit Thermo Fisher #23227 RNeasy Micro Kit Qiagen #74004 RNeasy Mini Kit Qiagen #74106 iScript cDNA Synthesis Kit BIO-RAD #1708891 Applied Biosystems TaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNG Thermo Fisher #4352042 Reagent/resource Reference or source Identifier or catalog number NEBNext Ultra II RNA Library Prep Kit for Illumina Bionordika #E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module Bionordika #E7490S LIVE/DEADTM Fixable Violet Dead Cell Stain Kit Thermo Fisher #L34964 A647 Phalloidin Thermo Fisher #A22287 8–16% polyacrylamide gels Bio-Rad #4561105 Chemiluminescent HRP substrate kit Thermo Fisher #34579 Acetyl-CoA ELISA kit Biomol #G-AEES00006.96 Zeiss LSM 780 Zeiss Leica Microsystems DMIL-LED microscope Leica Microsystems QuantStudio 7 Flex Applied Biosystems StepOne plus realtime qPCR system Applied Biosystems Illumina NextSeq 2000 Illumina Illumina NextSeq 500 Illumina BD LSRFortessa BD Biosciences Sony SH800 Sony BD FACS Aria III BD Biosciences VarioskantTM LUX Multimode Microplate Reader Thermo Fisher ..

    other:

    Article Title: Posttranscriptional control of hepatic CEACAM1 3 ′ UTR by human antigen R (HuR) mitigates sterile liver inflammation
    Article Snippet: 247 Application Gene Primer Duplex Pair RT-PCR AlbCre (mt) 5’-GAAGCAGAAGCTTAGGAAGATGG-3’ AlbCre (wt) 5’-TTGGCCCCTTACCATAACTG-3’ 5’- TGCAAACATCACATGCACAC-3’ Ceacam1-L 5’-GCTGGCATCGTGATTGGAGTTGTGG-3’ 5’-AGAGTTGTCAGAAGGAGCCAGATTG-3’ Ceacam1-S 5’-GCTGGCATCGTGATTGGAGTTGTGG-3’ 5’-AGAGTTGTCAGAAGGAGCCAGATCC-3’ Elavl1 5’-TAGGCTCTGGGATGAAACCT-3’ 5’-CTCTCCAGGCAGATGAGCA-3’ GAPDH 5’-GTCTCCTCTGACTTCAACAGCG-3’ 5’-ACCACCCTGTTGCTGTAGCCAA-3’ Application Gene ThermoFisher Reference Identifier qPCR CXCL10 Hs00171042 hnRNPA1 Mm00446190 Il1b Mm00434228 Il6 Mm01731480 Mcp1 Mm00441242 Ptpb1 Mm01303205 Tnfa Mm00443258 248 249 16 | P a g e Table S4.

    Article Title: miR-363-5p and IL-34 Mediated Modulation of Pacemaker Channel, HCN4, on iPSC-CM; Translation into the Human Sinus Node Microenvironment.
    Article Snippet: The raw data was acquired and exported to QuantStudio Real-Time PCR software (Thermo Fisher).

    Article Title: Overcoming BET-inhibitor JQ1 resistance in aggressive non-small cell lung cancer by inducing ferroptosis via inhibition of the BRD2-FTH1 axis.
    Article Snippet: Real-time PCR results were analyzed using QUANT STUDIO REAL-TIME PCR Software (Thermo Fisher Scientific).

    Protein Purification:

    Article Title: Humanized Mouse Models of Epstein Barr Virus Infection
    Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Sorvall ST40R (Thermo Fisher Scientific) PCR 8‐tube strips (VWR, 732‐1517) 384‐well LightCycler plate (Sarstedt, 72.1985.202) CFX384 Real‐Time PCR detection system (BioRad, C1000 Touch Thermal Cycler) TOMO IHC adhesive glass slides (Biosystems, TOM‐11/90) Software: Prism (GraphPad, Version 10.6.0) Phenochart (AKOYA Biosciences, Version 1.1.1) InForm (AKOYA Biosciences, Version 3.0.0) Vectra (AKOYA Biosciences, Version 3.0.7) Additional basic equipment: Herasafe laminar flow hood; class II (Thermo Fisher Scientific) Infrared lamp (in house) Mouse restrainer (in house) Multiwell 24‐well plates (Falcon, 353047) Nunc cell culture dish (Thermo Scientific, 153066) Omnican Syringe, U‐100 Insulin (Braun, 91511255) Pipetgirl (Vitaris) 5‐ml round‐bottom polystyrene tube with cell strainer cap (Falcon, 352235) Scissors (in house) Stainless steel surgical blades (Swann‐Morton, 0301) 3.5‐ml transfer pipette (Sarstedt, 86.1171.001) Tweezers (in house) ..

    Immunohistochemistry:

    Article Title: Humanized Mouse Models of Epstein Barr Virus Infection
    Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Sorvall ST40R (Thermo Fisher Scientific) PCR 8‐tube strips (VWR, 732‐1517) 384‐well LightCycler plate (Sarstedt, 72.1985.202) CFX384 Real‐Time PCR detection system (BioRad, C1000 Touch Thermal Cycler) TOMO IHC adhesive glass slides (Biosystems, TOM‐11/90) Software: Prism (GraphPad, Version 10.6.0) Phenochart (AKOYA Biosciences, Version 1.1.1) InForm (AKOYA Biosciences, Version 3.0.0) Vectra (AKOYA Biosciences, Version 3.0.7) Additional basic equipment: Herasafe laminar flow hood; class II (Thermo Fisher Scientific) Infrared lamp (in house) Mouse restrainer (in house) Multiwell 24‐well plates (Falcon, 353047) Nunc cell culture dish (Thermo Scientific, 153066) Omnican Syringe, U‐100 Insulin (Braun, 91511255) Pipetgirl (Vitaris) 5‐ml round‐bottom polystyrene tube with cell strainer cap (Falcon, 352235) Scissors (in house) Stainless steel surgical blades (Swann‐Morton, 0301) 3.5‐ml transfer pipette (Sarstedt, 86.1171.001) Tweezers (in house) ..

    Mass Measurement:

    Article Title: Humanized Mouse Models of Epstein Barr Virus Infection
    Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Sorvall ST40R (Thermo Fisher Scientific) PCR 8‐tube strips (VWR, 732‐1517) 384‐well LightCycler plate (Sarstedt, 72.1985.202) CFX384 Real‐Time PCR detection system (BioRad, C1000 Touch Thermal Cycler) TOMO IHC adhesive glass slides (Biosystems, TOM‐11/90) Software: Prism (GraphPad, Version 10.6.0) Phenochart (AKOYA Biosciences, Version 1.1.1) InForm (AKOYA Biosciences, Version 3.0.0) Vectra (AKOYA Biosciences, Version 3.0.7) Additional basic equipment: Herasafe laminar flow hood; class II (Thermo Fisher Scientific) Infrared lamp (in house) Mouse restrainer (in house) Multiwell 24‐well plates (Falcon, 353047) Nunc cell culture dish (Thermo Scientific, 153066) Omnican Syringe, U‐100 Insulin (Braun, 91511255) Pipetgirl (Vitaris) 5‐ml round‐bottom polystyrene tube with cell strainer cap (Falcon, 352235) Scissors (in house) Stainless steel surgical blades (Swann‐Morton, 0301) 3.5‐ml transfer pipette (Sarstedt, 86.1171.001) Tweezers (in house) ..

    Adhesive:

    Article Title: Humanized Mouse Models of Epstein Barr Virus Infection
    Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Sorvall ST40R (Thermo Fisher Scientific) PCR 8‐tube strips (VWR, 732‐1517) 384‐well LightCycler plate (Sarstedt, 72.1985.202) CFX384 Real‐Time PCR detection system (BioRad, C1000 Touch Thermal Cycler) TOMO IHC adhesive glass slides (Biosystems, TOM‐11/90) Software: Prism (GraphPad, Version 10.6.0) Phenochart (AKOYA Biosciences, Version 1.1.1) InForm (AKOYA Biosciences, Version 3.0.0) Vectra (AKOYA Biosciences, Version 3.0.7) Additional basic equipment: Herasafe laminar flow hood; class II (Thermo Fisher Scientific) Infrared lamp (in house) Mouse restrainer (in house) Multiwell 24‐well plates (Falcon, 353047) Nunc cell culture dish (Thermo Scientific, 153066) Omnican Syringe, U‐100 Insulin (Braun, 91511255) Pipetgirl (Vitaris) 5‐ml round‐bottom polystyrene tube with cell strainer cap (Falcon, 352235) Scissors (in house) Stainless steel surgical blades (Swann‐Morton, 0301) 3.5‐ml transfer pipette (Sarstedt, 86.1171.001) Tweezers (in house) ..

    Cell Culture:

    Article Title: Humanized Mouse Models of Epstein Barr Virus Infection
    Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Sorvall ST40R (Thermo Fisher Scientific) PCR 8‐tube strips (VWR, 732‐1517) 384‐well LightCycler plate (Sarstedt, 72.1985.202) CFX384 Real‐Time PCR detection system (BioRad, C1000 Touch Thermal Cycler) TOMO IHC adhesive glass slides (Biosystems, TOM‐11/90) Software: Prism (GraphPad, Version 10.6.0) Phenochart (AKOYA Biosciences, Version 1.1.1) InForm (AKOYA Biosciences, Version 3.0.0) Vectra (AKOYA Biosciences, Version 3.0.7) Additional basic equipment: Herasafe laminar flow hood; class II (Thermo Fisher Scientific) Infrared lamp (in house) Mouse restrainer (in house) Multiwell 24‐well plates (Falcon, 353047) Nunc cell culture dish (Thermo Scientific, 153066) Omnican Syringe, U‐100 Insulin (Braun, 91511255) Pipetgirl (Vitaris) 5‐ml round‐bottom polystyrene tube with cell strainer cap (Falcon, 352235) Scissors (in house) Stainless steel surgical blades (Swann‐Morton, 0301) 3.5‐ml transfer pipette (Sarstedt, 86.1171.001) Tweezers (in house) ..

    Transferring:

    Article Title: Humanized Mouse Models of Epstein Barr Virus Infection
    Article Snippet: .. NSG mice: NOD.Cg‐ Prkdc scid Il2rg tm1Wjl /SzJ (Jackson, strain no. 005557, RRID:IMSR_JAX:005557) PBS (in house; see Current Protocols, 2006) NucleoMag Pathogen DNA, RNA, and protein purification (Macherey‐Nagel, 744210.4) Ficoll‐Paque (GE Healthcare, 17‐5442‐03) DNeasy Blood & Tissue Kit (Qiagen, 69506) H O, molecular biology grade (PanReac AppliChem, A7398,0500) WHO International Standard (NIBSC code: 09/260) TaqMan Universal PCR Master Mix (Applied Biosystems, 4304437) Primers (see Table ) Formalin solution, 4% (w/v) (Formafix, 20 ml) Antibodies for IHC: Anti‐CD20 antibody (L26; Ventana, 760‐2531) Anti‐EBNA2 antibody (PE2; Abcam, ab90543) OptiView DAB IHC detection kit (Roche, 06396500001) ultraView Universal AP Red detection kit (Roche, 05269814001) K2E blood collection tubes (BD Microtainer, 365975) DxH 500 hematology analyzer (Beckman Coulter) 1.5‐ml SafeSeal tubes (Sarstedt, 7004159) 10‐, 200‐, and 1000‐μl pipettes and tips (Eppendorf) Tube shaker NucleoMag SEP Mini magnetic separator (Macherey‐Nagel, 744901) Analytical balance (Kern‐Sohn, TADJ 200‐4‐A) Cell strainer, 70‐μm (Falcon, 352350) Plastic tubes, 50‐ and 15‐ml (Sarstedt, 7510521 and 7510105) 2‐ml syringes, Injekt Luer Solo (B. Braun Medical AG, 4606027V) Centrifuge, Sorvall ST40R (Thermo Fisher Scientific) PCR 8‐tube strips (VWR, 732‐1517) 384‐well LightCycler plate (Sarstedt, 72.1985.202) CFX384 Real‐Time PCR detection system (BioRad, C1000 Touch Thermal Cycler) TOMO IHC adhesive glass slides (Biosystems, TOM‐11/90) Software: Prism (GraphPad, Version 10.6.0) Phenochart (AKOYA Biosciences, Version 1.1.1) InForm (AKOYA Biosciences, Version 3.0.0) Vectra (AKOYA Biosciences, Version 3.0.7) Additional basic equipment: Herasafe laminar flow hood; class II (Thermo Fisher Scientific) Infrared lamp (in house) Mouse restrainer (in house) Multiwell 24‐well plates (Falcon, 353047) Nunc cell culture dish (Thermo Scientific, 153066) Omnican Syringe, U‐100 Insulin (Braun, 91511255) Pipetgirl (Vitaris) 5‐ml round‐bottom polystyrene tube with cell strainer cap (Falcon, 352235) Scissors (in house) Stainless steel surgical blades (Swann‐Morton, 0301) 3.5‐ml transfer pipette (Sarstedt, 86.1171.001) Tweezers (in house) ..

    Positron Emission Tomography:

    Article Title: Deltaviruses spread through a viral Trojan Horse.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 N/A AreTomo2 Zheng et al. 66 N/A SerialEM Mastronarde 64 N/A Other Heraeus Multifuge X3 FR Thermo Fisher Scientific N/A TX-1000 swinging rotor Thermo Fisher Scientific N/A ImageXpress Pico microscope Molecular Devices N/A OPTIMA L-80 XP Beckman N/A SW 32Ti swinging rotor Beckman N/A Fiberlite F15-8 x 50cy fixed angle rotor Thermo Fisher Scientific N/A Fresco 21 centrifuge Thermo Fisher Scientific N/A Amicon-Ultra centrifugal filters Merck N/A SL 16R centrifuge Thermo Fisher Scientific N/A Trans-Blot Turbo Transfer System Bio-Rad N/A Odyssey M Infrared Imaging System LI-COR Biosciences N/A ChemiDoc system Bio-Rad N/A CFX Opus 384 Real-Time PCR System Bio-Rad N/A IX71 microscope Evident N/A PELCO Easyslicer Ted pella 11000 PET membrane insert (clear extended culture, 0.4-μm pore size) Sabeu 9300422 Andor Dragonfly spinning disk microscope Oxford Instruments N/A LSM980 8Y microscope with Airyscan 2 module ZEISS N/A ExpertLine STED microscope Abberior Instruments N/A JEM-1011 Transmission Electron Microscope JEOL N/A QuantiFoil Copper R 1.2/1.3 300-mesh holey carbon grids Micro Tools N/A Glacios cryo-TEM Thermo Fisher Scientific N/A Leica EM GP2 Leica N/A JEOL2200FS microscope JEOL N/A JPK CoverslipHolder Bruker N/A NanoWizard IVxp atomic force microscope Bruker Nano N/A BL-AC40TS probes Olympus N/A qpBioAC-CB3 Nanosensors N/A Pelco Biowave Pro+ tissue processor Ted pella N/A Beem embedding capsules size 3 EMS 69910 (Continued on next page) ll OPEN ACCESS e4 Cell 189, 1–14.e1–e10, April 30, 2026 Please cite this article in press as: McKellar et al., Deltaviruses spread through a viral Trojan Horse, Cell (2026), https://doi.org/10.1016/ j.cell.2026.01.037 Article .. NIH3T3 (CVCL_0594), Vero (CVCL_0059), Huh7.5 (CVCL_7927), HEK293T (CVCL_0063) and BHK-21 (CVCL_1914) were grown in Dulbecco’s Modified Eagle Medium (DMEM), high glucose (Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS) (Dutscher) and Antibiotic-Antimycotic 1X (Thermo Fisher Scientific) at 37 ◦ C, 5% CO 2 .

    Membrane:

    Article Title: Deltaviruses spread through a viral Trojan Horse.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 N/A AreTomo2 Zheng et al. 66 N/A SerialEM Mastronarde 64 N/A Other Heraeus Multifuge X3 FR Thermo Fisher Scientific N/A TX-1000 swinging rotor Thermo Fisher Scientific N/A ImageXpress Pico microscope Molecular Devices N/A OPTIMA L-80 XP Beckman N/A SW 32Ti swinging rotor Beckman N/A Fiberlite F15-8 x 50cy fixed angle rotor Thermo Fisher Scientific N/A Fresco 21 centrifuge Thermo Fisher Scientific N/A Amicon-Ultra centrifugal filters Merck N/A SL 16R centrifuge Thermo Fisher Scientific N/A Trans-Blot Turbo Transfer System Bio-Rad N/A Odyssey M Infrared Imaging System LI-COR Biosciences N/A ChemiDoc system Bio-Rad N/A CFX Opus 384 Real-Time PCR System Bio-Rad N/A IX71 microscope Evident N/A PELCO Easyslicer Ted pella 11000 PET membrane insert (clear extended culture, 0.4-μm pore size) Sabeu 9300422 Andor Dragonfly spinning disk microscope Oxford Instruments N/A LSM980 8Y microscope with Airyscan 2 module ZEISS N/A ExpertLine STED microscope Abberior Instruments N/A JEM-1011 Transmission Electron Microscope JEOL N/A QuantiFoil Copper R 1.2/1.3 300-mesh holey carbon grids Micro Tools N/A Glacios cryo-TEM Thermo Fisher Scientific N/A Leica EM GP2 Leica N/A JEOL2200FS microscope JEOL N/A JPK CoverslipHolder Bruker N/A NanoWizard IVxp atomic force microscope Bruker Nano N/A BL-AC40TS probes Olympus N/A qpBioAC-CB3 Nanosensors N/A Pelco Biowave Pro+ tissue processor Ted pella N/A Beem embedding capsules size 3 EMS 69910 (Continued on next page) ll OPEN ACCESS e4 Cell 189, 1–14.e1–e10, April 30, 2026 Please cite this article in press as: McKellar et al., Deltaviruses spread through a viral Trojan Horse, Cell (2026), https://doi.org/10.1016/ j.cell.2026.01.037 Article .. NIH3T3 (CVCL_0594), Vero (CVCL_0059), Huh7.5 (CVCL_7927), HEK293T (CVCL_0063) and BHK-21 (CVCL_1914) were grown in Dulbecco’s Modified Eagle Medium (DMEM), high glucose (Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS) (Dutscher) and Antibiotic-Antimycotic 1X (Thermo Fisher Scientific) at 37 ◦ C, 5% CO 2 .

    Pore Size:

    Article Title: Deltaviruses spread through a viral Trojan Horse.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 N/A AreTomo2 Zheng et al. 66 N/A SerialEM Mastronarde 64 N/A Other Heraeus Multifuge X3 FR Thermo Fisher Scientific N/A TX-1000 swinging rotor Thermo Fisher Scientific N/A ImageXpress Pico microscope Molecular Devices N/A OPTIMA L-80 XP Beckman N/A SW 32Ti swinging rotor Beckman N/A Fiberlite F15-8 x 50cy fixed angle rotor Thermo Fisher Scientific N/A Fresco 21 centrifuge Thermo Fisher Scientific N/A Amicon-Ultra centrifugal filters Merck N/A SL 16R centrifuge Thermo Fisher Scientific N/A Trans-Blot Turbo Transfer System Bio-Rad N/A Odyssey M Infrared Imaging System LI-COR Biosciences N/A ChemiDoc system Bio-Rad N/A CFX Opus 384 Real-Time PCR System Bio-Rad N/A IX71 microscope Evident N/A PELCO Easyslicer Ted pella 11000 PET membrane insert (clear extended culture, 0.4-μm pore size) Sabeu 9300422 Andor Dragonfly spinning disk microscope Oxford Instruments N/A LSM980 8Y microscope with Airyscan 2 module ZEISS N/A ExpertLine STED microscope Abberior Instruments N/A JEM-1011 Transmission Electron Microscope JEOL N/A QuantiFoil Copper R 1.2/1.3 300-mesh holey carbon grids Micro Tools N/A Glacios cryo-TEM Thermo Fisher Scientific N/A Leica EM GP2 Leica N/A JEOL2200FS microscope JEOL N/A JPK CoverslipHolder Bruker N/A NanoWizard IVxp atomic force microscope Bruker Nano N/A BL-AC40TS probes Olympus N/A qpBioAC-CB3 Nanosensors N/A Pelco Biowave Pro+ tissue processor Ted pella N/A Beem embedding capsules size 3 EMS 69910 (Continued on next page) ll OPEN ACCESS e4 Cell 189, 1–14.e1–e10, April 30, 2026 Please cite this article in press as: McKellar et al., Deltaviruses spread through a viral Trojan Horse, Cell (2026), https://doi.org/10.1016/ j.cell.2026.01.037 Article .. NIH3T3 (CVCL_0594), Vero (CVCL_0059), Huh7.5 (CVCL_7927), HEK293T (CVCL_0063) and BHK-21 (CVCL_1914) were grown in Dulbecco’s Modified Eagle Medium (DMEM), high glucose (Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS) (Dutscher) and Antibiotic-Antimycotic 1X (Thermo Fisher Scientific) at 37 ◦ C, 5% CO 2 .

    Transmission Assay:

    Article Title: Deltaviruses spread through a viral Trojan Horse.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 N/A AreTomo2 Zheng et al. 66 N/A SerialEM Mastronarde 64 N/A Other Heraeus Multifuge X3 FR Thermo Fisher Scientific N/A TX-1000 swinging rotor Thermo Fisher Scientific N/A ImageXpress Pico microscope Molecular Devices N/A OPTIMA L-80 XP Beckman N/A SW 32Ti swinging rotor Beckman N/A Fiberlite F15-8 x 50cy fixed angle rotor Thermo Fisher Scientific N/A Fresco 21 centrifuge Thermo Fisher Scientific N/A Amicon-Ultra centrifugal filters Merck N/A SL 16R centrifuge Thermo Fisher Scientific N/A Trans-Blot Turbo Transfer System Bio-Rad N/A Odyssey M Infrared Imaging System LI-COR Biosciences N/A ChemiDoc system Bio-Rad N/A CFX Opus 384 Real-Time PCR System Bio-Rad N/A IX71 microscope Evident N/A PELCO Easyslicer Ted pella 11000 PET membrane insert (clear extended culture, 0.4-μm pore size) Sabeu 9300422 Andor Dragonfly spinning disk microscope Oxford Instruments N/A LSM980 8Y microscope with Airyscan 2 module ZEISS N/A ExpertLine STED microscope Abberior Instruments N/A JEM-1011 Transmission Electron Microscope JEOL N/A QuantiFoil Copper R 1.2/1.3 300-mesh holey carbon grids Micro Tools N/A Glacios cryo-TEM Thermo Fisher Scientific N/A Leica EM GP2 Leica N/A JEOL2200FS microscope JEOL N/A JPK CoverslipHolder Bruker N/A NanoWizard IVxp atomic force microscope Bruker Nano N/A BL-AC40TS probes Olympus N/A qpBioAC-CB3 Nanosensors N/A Pelco Biowave Pro+ tissue processor Ted pella N/A Beem embedding capsules size 3 EMS 69910 (Continued on next page) ll OPEN ACCESS e4 Cell 189, 1–14.e1–e10, April 30, 2026 Please cite this article in press as: McKellar et al., Deltaviruses spread through a viral Trojan Horse, Cell (2026), https://doi.org/10.1016/ j.cell.2026.01.037 Article .. NIH3T3 (CVCL_0594), Vero (CVCL_0059), Huh7.5 (CVCL_7927), HEK293T (CVCL_0063) and BHK-21 (CVCL_1914) were grown in Dulbecco’s Modified Eagle Medium (DMEM), high glucose (Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS) (Dutscher) and Antibiotic-Antimycotic 1X (Thermo Fisher Scientific) at 37 ◦ C, 5% CO 2 .

    Capsules:

    Article Title: Deltaviruses spread through a viral Trojan Horse.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER mmDeV-2xgenome Iwamoto et al. 8 N/A RDeV-2xgenome Paraskevopoulou et al. 6 N/A Software and algorithms Trojan Horse Quantifier This Study. https://github.com/ant-trullo/ Trojan_Horse_Quantifier Fiji Is Just ImageJ (FIJI) Schindelin et al. 60 N/A IMARIS Oxford Instruments N/A SPM-data processing software Bruker Nano N/A TRUESHARP image boosting tool Abberior N/A Huygens Professional 24.10 software Scientific Volume Imaging B.V. N/A Cellpose Stringer et al. 67 N/A CFX manager suite Bio-Rad N/A ZEN Blue software ZEISS N/A GraphPad PRISM GraphPad N/A WARP Tegunov et al. 65 N/A AreTomo2 Zheng et al. 66 N/A SerialEM Mastronarde 64 N/A Other Heraeus Multifuge X3 FR Thermo Fisher Scientific N/A TX-1000 swinging rotor Thermo Fisher Scientific N/A ImageXpress Pico microscope Molecular Devices N/A OPTIMA L-80 XP Beckman N/A SW 32Ti swinging rotor Beckman N/A Fiberlite F15-8 x 50cy fixed angle rotor Thermo Fisher Scientific N/A Fresco 21 centrifuge Thermo Fisher Scientific N/A Amicon-Ultra centrifugal filters Merck N/A SL 16R centrifuge Thermo Fisher Scientific N/A Trans-Blot Turbo Transfer System Bio-Rad N/A Odyssey M Infrared Imaging System LI-COR Biosciences N/A ChemiDoc system Bio-Rad N/A CFX Opus 384 Real-Time PCR System Bio-Rad N/A IX71 microscope Evident N/A PELCO Easyslicer Ted pella 11000 PET membrane insert (clear extended culture, 0.4-μm pore size) Sabeu 9300422 Andor Dragonfly spinning disk microscope Oxford Instruments N/A LSM980 8Y microscope with Airyscan 2 module ZEISS N/A ExpertLine STED microscope Abberior Instruments N/A JEM-1011 Transmission Electron Microscope JEOL N/A QuantiFoil Copper R 1.2/1.3 300-mesh holey carbon grids Micro Tools N/A Glacios cryo-TEM Thermo Fisher Scientific N/A Leica EM GP2 Leica N/A JEOL2200FS microscope JEOL N/A JPK CoverslipHolder Bruker N/A NanoWizard IVxp atomic force microscope Bruker Nano N/A BL-AC40TS probes Olympus N/A qpBioAC-CB3 Nanosensors N/A Pelco Biowave Pro+ tissue processor Ted pella N/A Beem embedding capsules size 3 EMS 69910 (Continued on next page) ll OPEN ACCESS e4 Cell 189, 1–14.e1–e10, April 30, 2026 Please cite this article in press as: McKellar et al., Deltaviruses spread through a viral Trojan Horse, Cell (2026), https://doi.org/10.1016/ j.cell.2026.01.037 Article .. NIH3T3 (CVCL_0594), Vero (CVCL_0059), Huh7.5 (CVCL_7927), HEK293T (CVCL_0063) and BHK-21 (CVCL_1914) were grown in Dulbecco’s Modified Eagle Medium (DMEM), high glucose (Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS) (Dutscher) and Antibiotic-Antimycotic 1X (Thermo Fisher Scientific) at 37 ◦ C, 5% CO 2 .

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 QdotTM585 streptavidin conjugate Invitrogen #Q10111MP Software FlowJo 8.7 FlowJo, 385 Williamson Way Ashland, OR 97520 USA https://www.flowjo.com/ Fiji 2.1.0/1.53c Image J, NIH, Bethesda, USA https://fiji.sc GraphPad Prism 9 GraphPad Prism 225 Franklin Street Boston, MA 02110 USA https:// www.graphpad.com Other Flow cytometer (LSRII) BD N/A DM2500 light/fluorescence microscope Leica N/A Axio Vision microscope Zeiss N/A Quantitative PCR instrument: StepOnePlus ABI 7500 sequence detection system Applied Biosystems N/A ..

    SYBR Green Assay:

    Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 QdotTM585 streptavidin conjugate Invitrogen #Q10111MP Software FlowJo 8.7 FlowJo, 385 Williamson Way Ashland, OR 97520 USA https://www.flowjo.com/ Fiji 2.1.0/1.53c Image J, NIH, Bethesda, USA https://fiji.sc GraphPad Prism 9 GraphPad Prism 225 Franklin Street Boston, MA 02110 USA https:// www.graphpad.com Other Flow cytometer (LSRII) BD N/A DM2500 light/fluorescence microscope Leica N/A Axio Vision microscope Zeiss N/A Quantitative PCR instrument: StepOnePlus ABI 7500 sequence detection system Applied Biosystems N/A ..

    Flow Cytometry:

    Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 QdotTM585 streptavidin conjugate Invitrogen #Q10111MP Software FlowJo 8.7 FlowJo, 385 Williamson Way Ashland, OR 97520 USA https://www.flowjo.com/ Fiji 2.1.0/1.53c Image J, NIH, Bethesda, USA https://fiji.sc GraphPad Prism 9 GraphPad Prism 225 Franklin Street Boston, MA 02110 USA https:// www.graphpad.com Other Flow cytometer (LSRII) BD N/A DM2500 light/fluorescence microscope Leica N/A Axio Vision microscope Zeiss N/A Quantitative PCR instrument: StepOnePlus ABI 7500 sequence detection system Applied Biosystems N/A ..

    Sequencing:

    Article Title: Complete attenuation of Plasmodium falciparum sporozoites by atovaquone-proguanil.
    Article Snippet: Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Huh-7 Human hepatoma cells Nakabayashi et al (1982) C57BL/6J mice Charles River RRID:IMSR_JAX:000664 NMRI mice Charles River RRID:IMSR_CRL:605 Anopheles stephensi SK Feldmann and Ponnudurai, 1989; PMID: 2519646 Feldmann and Ponnudurai (1989) Plasmodium berghei clone 507 Janse et al, 2006; PMID: 16242190 Janse et al (2006) PfSPZ Sanaria GMP-produced Plasmodium falciparum NF54 sporozoites for phase I clinical trial Recombinant DNA – – – Antibodies Anti-mouse CD8a-PerCP-Cy5.5 (53-6.7) Thermo Fisher Scientific Cat# 45-0081-82, RRID: AB_1107004 Anti-mouse CD11a-e450 (M17/4) Thermo Fisher Scientific Cat#48-0111-82, RRID: AB_11064445 Anti-mouse CD62L-PE-Cy7 (MEL-14) Thermo Fisher Scientific Cat# 25-0621-82, RRID: AB_469633 Anti-mouse IFN- γ-APC (XMG1.2) Thermo Fisher Scientific Cat# 17-7311-82, RRID: AB_469504 Rabbit polyclonal anti-Plasmodium berghei UIS4 Müller et al, 2011; PMID: 21673790 Müller et al (2011) Mouse anti-Plasmodium berghei HSP70 Tsuji et al, 1994; PMID: 8153120 RRID:AB_2650482 Alexa Fluor 488 goat anti-mouse Thermo Fisher Scientific Cat # A-11029 RRID: AB_2534088 Alexa Fluor 546 goat anti-mouse Thermo Fisher Scientific Cat # A-11003 AB_2534071 Alexa Fluor 546 goat anti-rabbit Thermo Fisher Scientific Cat # A-11010 RRID:AB_2534077 Goat anti-human IgG-HRP Jackson ImmunoResearch #109-035-098 Goat anti-human IgM-HRP ImmunoReagents #GtxHu-006-E2HRPX Human IgG ThermoFisher #31154 Human IgM Sigma-Aldrich #I8260 Goat anti-human IgG QDotTM 800 Grace Bio-Labs #110635 Biotin-SP-conjugated goat anti-human IgM Jackson ImmunoResearch #109-065-043 Oligonucleotides and other sequence-based reagents P. berghei 18SrRNA (GI, 160641) forward: 5′- AAGCATTAAATAAAGCGAATACATCCTTAC3′; reverse: 5′- GGAGATTGGTTTTGACGTTTATGTG-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Mouse GAPDH gene (GI, 281199965) forward: 5′-CGTCCCGTAGACAAAATGGT-3′; reverse: 5′-TTGATGGCAACAATCTCCAC-3′ Friesen et al, 2010; PMID: 20630856 Friesen et al (2010) Chemicals, enzymes and other reagents Acetone Roth Cat # 9780.2 Brefeldin A eBioscience/ Invitrogen Cat # 00-4506-51 Dimethyl sulfoxide (DMSO) PanReac AppliChem Cat # A3672,0100 DMEM Gibco/Thermo Fisher Scientific Cat # 11965092 Foetal Bovine Serum (South America) Gibco/Thermo Fisher Scientific Cat # 10500064 Fluoromount-G Southern Biotech, Biozol Cat # 0100-01 © The Author(s) EMBO Molecular Medicine 11 D ow nloaded from https://w w w .em bopress.org on O ctober 10, 2025 from IP 202.51.89.179. .. Reagent/resource Reference or source Identifier or catalogue number Giemsa Sigma-Aldrich/ Merck Cat # 1.09204.0500 Hoechst 33342 Invitrogen/ Thermo Fisher Scientific Cat # H3570 Lab-Tek 8 Nunc/Thermo Fisher Scientific Cat # 177410PK MicroAmp 96-well RT-PCR plates Applied Biosystems/ Thermo Fisher Scientific Cat # N8010560 Paraformaldehyd Sigma-Aldrich Cat # 44124-1KG PBS Gibco/Thermo Fisher Scientific Cat # 10010023 Penicillin-Streptomycin Gibco/Thermo Fisher Scientific Cat # 15140122 Perm-Wash Buffer BD Cat # 554723 Power SYBR Green: PCR Master-Mix Applied Biosystems/ Thermo Fisher Scientific Cat # 4367659 Retroscript Kit Ambion/Thermo Fisher Scientific Cat # AM1710 RNeasy Mini Kit QIAGEN Cat # 74104 RNAse-Free DNAse Set QIAGEN Cat # 79254 RPMI 1640 Gibco/Thermo Fisher Scientific Cat # 11875093 TRIzol reagent Invitrogen/ Thermo Fisher Scientific Cat # 15596026 QdotTM585 streptavidin conjugate Invitrogen #Q10111MP Software FlowJo 8.7 FlowJo, 385 Williamson Way Ashland, OR 97520 USA https://www.flowjo.com/ Fiji 2.1.0/1.53c Image J, NIH, Bethesda, USA https://fiji.sc GraphPad Prism 9 GraphPad Prism 225 Franklin Street Boston, MA 02110 USA https:// www.graphpad.com Other Flow cytometer (LSRII) BD N/A DM2500 light/fluorescence microscope Leica N/A Axio Vision microscope Zeiss N/A Quantitative PCR instrument: StepOnePlus ABI 7500 sequence detection system Applied Biosystems N/A ..



    Similar Products

    99
    ATCC application time
    Application Time, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/application+time/TIME/10__1002_slash_ppap__70102-161-32-48
    Average 99 stars, based on 1 article reviews
    application time - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    93
    Genovis Inc time reversal operator application
    Time Reversal Operator Application, supplied by Genovis Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/application+time/OpeRATOR+Lyophilized/pmc12309695__sciadv%2Eadt9778_sm-412-15-17
    Average 93 stars, based on 1 article reviews
    time reversal operator application - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    90
    Thermo Fisher application biosystem 7500 real-time pcr system
    Application Biosystem 7500 Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/application+time/application+biosystem+7500+real+time+pcr+system/pm40139472-40-1-7
    Average 90 stars, based on 1 article reviews
    application biosystem 7500 real-time pcr system - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    96
    MathWorks Inc time application
    Time Application, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/application+time/Simulink+Real-Time/10__3390_slash_automation6030045-233-8-11
    Average 96 stars, based on 1 article reviews
    time application - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    86
    Zoom Video Communications Inc zoom real time video application
    Zoom Real Time Video Application, supplied by Zoom Video Communications Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/application+time/application+real+time+video+zoom/pm40945190-71-7-11
    Average 86 stars, based on 1 article reviews
    zoom real time video application - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    90
    Janssen application of chernobyl caesium-137 fallout and naturally occurring lead-210 for standardization of time in moss samples
    Application Of Chernobyl Caesium 137 Fallout And Naturally Occurring Lead 210 For Standardization Of Time In Moss Samples, supplied by Janssen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/application+time/application+of+chernobyl+caesium+137+fallout+and+naturally+occurring+lead+210+for+standardization+of+time+in+moss+samples/pm40027244-223-11-0
    Average 90 stars, based on 1 article reviews
    application of chernobyl caesium-137 fallout and naturally occurring lead-210 for standardization of time in moss samples - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    96
    MathWorks Inc time applications
    Time Applications, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/application+time/Simulink+Real-Time/pm40155678-429-8-11
    Average 96 stars, based on 1 article reviews
    time applications - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    90
    Biosense Webster real-time automated display of rf applications visitag
    Real Time Automated Display Of Rf Applications Visitag, supplied by Biosense Webster, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/application+time/real+time+automated+display+of+rf+applications+visitag/pm40148702-62-1-10
    Average 90 stars, based on 1 article reviews
    real-time automated display of rf applications visitag - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results